The 5alpha-reductase type 1, but not type 2, gene is expressed in anagen hairs plucked from the vertex area of the scalp of hirsute women and normal individuals

of 8
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Information Report
Category:

Abstract

Published:

Views: 34 | Pages: 8

Extension: PDF | Download: 0

Share
Description
The 5alpha-reductase type 1, but not type 2, gene is expressed in anagen hairs plucked from the vertex area of the scalp of hirsute women and normal individuals
Tags
Transcript
  1447Braz J Med Biol Res 36(10) 2003Gene expression of 5 α -reductase isoenzymes in plucked hairs   Brazilian Journal of Medical and Biological Research (2003) 36: 1447-1454ISSN 0100-879X The 5alpha-reductase type 1, but nottype 2, gene is expressed in anagenhairs plucked from the vertex area of the scalp of hirsute women and normalindividuals 1 Departamento de Fisiologia, Universidade Federal do Rio Grande do Sul,Porto Alegre, RS, Brasil 2 Departamento de Fisiologia e Farmacologia, Universidade Federal de Pelotas,Pelotas, RS, Brasil 3 Unidade de Endocrinologia Ginecológica, Serviço de Endocrinologia,Hospital de Clínicas de Porto Alegre, Porto Alegre, RS, BrasilI.O. Oliveira 1,2 ,C. Lhullier 1 ,I.S. Brum 1  andP.M. Spritzer 1,3  Abstract The aim of the present study was to determine the expression of thegenes for type 1 (SDR5A1) and type 2 (SDR5A2) 5 α -reductaseisoenzymes in scalp hairs plucked from 33 hirsute patients (20 with polycystic ovary syndrome and 13 with idiopathic hirsutism) andcompare it with that of 10 men and 15 normal women. SDR5A1 andSDR5A2 expression was estimated by RT-PCR using the gene of theubiquitously expressed protein ß 2 -microglobulin as an internal con-trol. The results are expressed as arbitrary units in relation to ß 2 -microglobulin absorbance (mean ± SEM). SDR5A2 expression wasnot detected in any hair samples analyzed in this study. No differenceswere found in SDR5A1 mRNA levels between men and normalwomen (0.78 ± 0.05 vs  0.74 ± 0.06, respectively). SDR5A1 geneexpression in the cells of hair plucked from the scalp of normal women(0.85 ± 0.04) and of women with polycystic ovary syndrome (0.78 ±0.05) and idiopathic hirsutism (0.80 ± 0.06) was also similar. Theseresults indicate that SDR5A1 gene expression in the follicular keratin-ocytes from the vertex area of the scalp seems not to be related to thedifferences in hair growth observed between normal men and womenand hirsute patients. Further studies are needed to   investigate theexpression of the 5 α -reductase genes in other scalp follicular compart-ments such as dermal papillae, and also in hair follicles from other  body sites, in order to elucidate the mechanism of androgen action onthe hair growth process and related diseases. Correspondence P.M. SpritzerDepartamento de Fisiologia, UFRGSRua Sarmento Leite, 50090050-170 Porto Alegre, RSBrasilFax: +55-51-3316-3453E-mail: spritzer@vortex.ufrgs.brResearch supported by CNPq,FAPERGS, CAPES (PICDT) andPronex (26/98).Received November 25, 2002 Accepted June 30, 2003 Key words • Hair follicle • Hirsutism • 5 α -Reductase • Polycystic ovary syndrome  1448Braz J Med Biol Res 36(10) 2003I.O. Oliveira et al. Introduction Androgens are the main regulators of human hair growth and are associated withone of the major clinical hair growth disor-ders, namely hirsutism. This condition cor-responds to excessive body hair growth inwomen with a male pattern of body hair distribution. The presence of hirsutism cansignal conditions associated with increasedandrogen secretion by ovaries and/or adrenalssuch as polycystic ovary syndrome (PCOS),androgen-secreting tumors, and nonclassicadrenal hyperplasia or can result from pe-ripheral hypersensitivity to circulating an-drogens (idiopathic hirsutism, IH) (1-3). Al-though in general this condition is not lifethreatening, it is greatly distressing to pa-tients and has a significant negative psycho-social impact. Investigating the effects of androgens on hair growth in the presence of hirsutism should improve our knowledge of human hair follicle biology.The effect of all active androgens on targetcells is mediated by their binding to the samenuclear androgen receptor. Previous studieson androgen resistance syndromes have re-vealed the importance of the androgen recep-tor for androgen-dependent hair growth (4-6).More recently, an increased androgen bindingcapacity was observed in scalp hair cells of  balding men (7). However, no consistent dif-ference has been found thus far in the number or function of the androgen receptor in hirsute patients compared to normal subjects (8,9).Hair follicles have autonomous controlover androgen metabolism, adjusting the pro-duction and degradation of steroid hormonesaccording to local requirements (10). Under normal conditions, 5 α -reductase has a keyrole in the action of androgens on hair fol-licles, converting testosterone to the more potent androgen dihydrotestosterone (11,12).Studies of molecular cloning have character-ized two genes that encode the type 1 andtype 2 5 α -reductase isoenzymes (13,14). The5 α -reductase isoenzyme predominant in theskin is type 1 (SDR5A1) (15), which has60% homology with 5 α -reductase type 2(SDR5A2) that is characteristic of the pros-tate gland (14). An increase in 5 α -reductaseactivity was demonstrated in genital and pu- bic skin fibroblasts from hirsute patients incomparison to the skin of normal women(8,16). These studies have reported an in-crease in 5 α -reductase activity even in IH,which is characterized by the absence of elevated plasma androgen levels (17). More-over, pubic skin of hirsute patients expressesthe same SDR5A1 isoform as pubic skin of normal subjects, whereas SDR5A2 is mainlyexpressed in genital skin from both normalsubjects and hirsute patients (18). However,the physiological role of 5 α -reductase isoen-zymes is not completely understood and their distribution in different skin compartmentsis still unclear. Some immunohistochemicaland enzyme activity studies have suggesteda predominant expression of SDR5A1 en-zyme in sebaceous glands, but also in sweatglands, epidermal cells, root sheath and der-mal papilla cells from hair follicles (19-21),whereas SDR5A2 is only expressed in thesecompartments at very low levels. In contrast,other studies have demonstrated a differentdistribution of these isoenzymes inside the pilosebaceous unit (22-24). There seems to be a higher distribution of SDR5A1 in hair follicle compartments compared to SDR5A2.Furthermore, since root sheath keratinocytesshow high expression of the SDR5A1 gene,they probably play an important role in an-drogen metabolism in hair follicles.The aim of the present study was to assessthe expression of the SDR5A1 and SDR5A2genes in hair root sheath cells of the vertex areaof scalp from hirsute patients and compare itwith normal subjects of both sexes. Patients and Methods Subjects The study population included women  1449Braz J Med Biol Res 36(10) 2003Gene expression of 5 α -reductase isoenzymes in plucked hairs consulting for hirsutism seen consecutivelyduring a 6-month period at the Gynecologi-cal Endocrinology Unit of Hospital de Clíni-cas de Porto Alegre, Brazil. Thirty-three pa-tients ranging in age from 12 to 42 yearswere selected for the study. Twenty patientswere diagnosed as having PCOS and 13 ashaving IH. The diagnosis of PCOS was basedon the physical features of hyperandrogenism,disturbed menstrual cycles, elevated serumluteinizing hormone (LH) levels or LH/follicle-stimulating hormone ratio, increasedlevels of total testosterone and/or free andro-gen index (FAI), ultrasound evidence of bi-lateral enlarged polycystic ovaries (25,26),and absence of ovarian or adrenal neoplasmor Cushing’s syndrome. IH was diagnosedas previously described (27) in hirsute pa-tients with regular ovulatory cycles (luteal phase progesterone levels higher than 3.8ng/ml), normal androgen levels, and withoutany known underlying disease.Late-onset (nonclassic) congenital adre-nal hyperplasia patients were not consideredfor the study on the basis of a high plasmalevel of 17-hydroxyprogesterone (>5 ng/ml)and/or its marked increase after ACTH stim-ulation (>12 ng/ml) (28,29). Patients withhyperprolactinemia (serum prolactin levelshigher than 20 µg/l on two different occa-sions) were also excluded.Fifteen normal women with regular men-strual cycles aged 16-37 years and ten menaged 16-29 years were also selected for thestudy, which was approved by the EthicsCommittee of Hospital de Clínicas de PortoAlegre. Informed consent was obtained fromeach subject. None of the subjects had re-ceived any drugs known to interfere withandrogen, estrogen or gonadotropin serumlevels for at least 3 months before the study.SDR5A1 and SDR5A2 mRNA levelswere estimated by the reverse transcription- polymerase chain reaction (RT-PCR) in hair cells plucked from the vertex portion of thescalp of normal men, normal women andhirsute patients. Study protocol Anthropometric measurements included body weight, height and body mass index(BMI = current measured weight in kg di-vided by height in m 2 ). Hirsutism score wasgraded by the Ferriman-Gallwey method(30), excluding the lower leg and forearmareas.Hormonal assessment was performed between day 2 and 10 of the menstrual cycleor on any day when the patients were amen-orrheic. After an overnight fast, bloodsamples were drawn from an antecubitalvein for determination of LH, sex hormone- binding globulin (SHBG)   and total testoster-one. All samples were obtained between 8and 10 am. The FAI was estimated by divid-ing total testosterone (nmol/l) by SHBG(nmol/l) x 100.  Assays Total testosterone was measured bydouble-antibody radioimmunoassay (ICN,Costa Mesa, CA, USA), with an assay detec-tion limit of 0.04 ng/ml and intra- and inter-assay coefficient of variance (CV) of 10 and15%, respectively; SHBG was measured byan immunochemiluminometric assay (ICMA;DPC, Los Angeles, CA, USA), with a detec-tion limit of 0.2 nmol/l, and intra- and inter-assay CV of 5.0 and 8.0%, respectively. LHwas measured by ICMA, with a detectionlimit of 0.7 mIU/ml and intra- and interassayCV of 5.2 and 8.0%, respectively. RT-PCR protocol Plucked anagen hairs were collected fromthe vertex of the scalp of all subjects andwere immediately frozen in liquid nitrogenand transported to the laboratory for assays.The extraction of total RNA and the synthe-sis of cDNA were carried out as previouslydescribed (31). The plucked hair roots werehomogenized in phenol-guanidine isothio-  1450Braz J Med Biol Res 36(10) 2003I.O. Oliveira et al. cyanate (Trizol, Gibco-BRL, Gaithersburg,MD, USA). Total RNA was extracted withchloroform and precipitated with isopropanol by 12,000  g   centrifugation at 4ºC. The RNA pellet was washed twice with 75% ethanol,resuspended in diethylpyrocarbonate-treatedwater, and quantified by absorbance at 260nm.First strand cDNA was synthesized from5 µg total RNA for all reactions using theSuperScript Preamplification System (Gibco-BRL). After denaturing the template RNAand primers at 70ºC for 10 min, reversetranscriptase was added in the presence of 20 mM Tris-HCl, pH 8.4, plus 50 mM KCl,2.5 mM MgCl 2 , 0.5 mM dNTP mix and 10mM dithiothreitol, and incubated at 42ºC for 55 min. The mixture was heated to 70ºC tostop the reaction and then incubated with  E.coli  RNase for 20 min at 37ºC to destroyuntranscribed RNA. The template (cDNA)used in the different PCR assays was ob-tained from the same reverse transcriptionreaction. PCR was carried out in a finalvolume of 50 µl. Two microliters of the firststrand synthesis reaction (with an expectedcDNA yield of 10 ng) was denatured at 94ºCfor 3 min (2 min only for ß 2 -microglobulin)in the presence of 20 mM Tris-HCl, pH 8.4, plus 50 mM KCl and 1.5 mM MgCl 2 . After this hot start, 1.25 U of Taq DNA poly-merase was added together with the sameTris-HCl buffer, 1.5 mM MgCl 2 , 0.4 µMsense and antisense primers and 0.2 mMdNTP mix.A 368-bp fragment of the SDR5A1 (24)and a 566-bp fragment of the SDR5A2 (14)cDNA sequence were amplified using prim-ers designed to span intron-exon borders inorder to prevent the amplification of anycontaminating genomic DNA. A 623-bpcDNA fragment corresponding to the ubiq-uitously expressed protein ß 2 -microglobulin(32) was amplified to normalize the cDNAamounts in each sample. The cDNA se-quences of SDR5A1 and SDR5A2 and ß 2 -microglobulin primers are listed in Table 1.PCR was standardized by testing a number of cycles (20 to 45) and amplification was performed in the linear range. Final PCR conditions were as follows: 35 cycles (45 s at94ºC, 45 s at 60ºC, 90 s at 72ºC, 10 min at72ºC) for SDR5A1, 40 cycles (1 min at94ºC, 1 min at 65ºC, 2 min at 72ºC, 5 min at72ºC) for SDR5A2, and 30 cycles (1 min at94ºC, 1 min at 55ºC, 1 min at 72ºC, 5 min at72ºC) for ß 2 -microglobulin. cDNA from dis-sociated cells of human prostate gland wasused as a positive control for all PCR reac-tions. No cDNA was added to the negativereactions. A sample of the PCR mixture (15µl) was size-fractionated on 1.5-2.0% aga-rose gel stained with ethidium bromide, run Table 1. Sequence of the primers related to SDR5A1, SDR5A2 and ß 2 -microglobulincDNA sequences and expected sizes of amplified fragments.GeneSequence (5'-3')Size of fragment(reference)SDR5A1SenseTGGCGCTTCTCTATGGACTT368 bp (21)AntisenseGGAAGCAACACTGCAGTTGASDR5A2SenseTACTTCTGGGCCTCTTCTGCG566 bp (14)AntisenseTTTCATCAGCATTGTGGGAGCß 2 -microglobulinSenseATCCAGCGTACTCCAAAGATTCAG623 bp (32)AntisenseAAATTGAAAGTTAACTTATGCACGCTable 2. Clinical and hormonal data for hirsute patients with polycystic ovary syn-drome (PCOS) and idiopathic hirsutism (IH).PCOSIHNormal valuesAge (years) a 23.0±1.224.3±1.7  - BMI (kg/m 2 ) a 30.7±1.426.8±1.1*  - Clinical score for hirsutism a 15.1±1.313.9±0.9<8Testosterone a  (ng/ml)0.89±0.070.64±0.06*0.20-0.81FAI a 15.3±1.738.8±1.34*5.50-11.20SHBG b  (nmol/l)24.4 (13.3-37.3)33.9 (22.5-45.2)20-118LH b  (IU/l)4.6 (2.1-9.1)2.7 (2.1-6.6)1.6-8.3 a Data are reported as mean ± SEM. b Values are reported as median and 95% confi-dence interval. BMI, body mass index; FAI, free androgen index; SHBG, sex hormone-binding globulin; LH, luteinizing hormone. *P < 0.05 compared to PCOS patients( a ANOVA followed by the Duncan test; b Mann-Whitney test).  1451Braz J Med Biol Res 36(10) 2003Gene expression of 5 α -reductase isoenzymes in plucked hairs at 100 V and visualized under UV light. Theexpected bands were quantified by densito-metric analysis using an image-processingsystem (ImageMaster VDS, PharmaciaBiotech, Uppsala, Sweden). Statistical analysis Data are reported as means ± SEM, un-less otherwise noted. Group means werecompared by the Student t  -test or by one-way analysis of variance (ANOVA) followed by the Duncan test, and median values werecompared by the Mann-Whitney test. Differ-ences were considered to be statistically sig-nificant at P < 0.05. All analyses were per-formed using the Statistical Packages for theSocial Sciences (SPSS, Inc., Chicago, IL,USA). Results Table 2 summarizes the anthropometricand hormonal data for patients with PCOSand IH. No significant differences were ob-served between the two groups of hirsute patients regarding age or clinical score for hirsutism. However, hirsute patients withPCOS presented higher BMI and showedsignificantly higher levels of testosterone,FAI and LH than the IH group. SHBG con-centrations were lower in the PCOS groupthan in the IH group.SDR5A2 gene expression was not de-tected in any scalp hair samples analyzed byRT-PCR in the present study (Figure 1).Figure 2 shows SDR5A1 mRNA levelsin hair cells plucked from the scalp of nor-mal subjects. SDR5A1 expression, presentedas arbitrary units in relation to ß 2 -micro-globulin absorbance, was similar in men(0.78 ± 0.05) and normal women (0.74 ±0.06). Furthermore, no significant differenceswere observed in follicular keratinocyteSDR5A1 expression between normal women(0.85 ± 0.04) and the PCOS (0.78 ± 0.04) or IH (0.80 ± 0.06) hirsute groups (Figure 3). Figure 2. Representative gel showing SDR5A1 mRNA levels determined by RT-PCR in haircells plucked from the scalp of men (1 to 7) and normal women (8 to 14). The 368-bpfragment corresponds to SDR5A1 (5 α -R1) and the 623-bp fragment corresponds to ß 2 -microglobulin (ß 2 -m). RT-PCR products were visualized on agarose gel stained with ethi-dium bromide. + = positive control.623 bp368 bpß 2 -m5 α -R1M1234567891011121314+ß 2 -m5 α -R1ß 2 -m5 α -R1ß 2 -m5 α -R1Figure 3. Representative gel showing SDR5A1 mRNA levels determined by RT-PCR in haircells plucked from the scalp of normal women (1 to 14) and of both groups of hirsutepatients (PCOS: 15 to 26; IH: 27 to 35). The 368-bp fragment corresponds to SDR5A1 (5 α -R1), and the 623-bp fragment corresponds to ß 2 -microglobulin (ß 2 -m). RT-PCR productswere visualized on agarose gel stained with ethidium bromide.623 bp368 bp623 bp368 bp623 bp368 bpM1234567891011121314M151617181920212223242526M272829303132333435Figure 1. Representative agarose gel stained with ethidium bromide showing no expres-sion of SDR5A2 mRNA by RT-PCR in hair cells plucked from the scalp of men (1 to 9),normal women (10 to 17) and hirsute patients: PCOS group (18 to 31) and IH group (32 to39). The 566-bp fragment corresponds to SDR5A2 (5 α -R2) and the 623-bp fragmentcorresponds to ß 2 -microglobulin (ß 2 -m). SDR5A2 amplification was visualized only indissociated prostatic cells used as positive control (+).623 bp566 bp623 bp566 bpß 2 -m5 α -R2ß 2 -m5 α -R2ß 2 -m5 α -R2623 bp566 bpM1234567891011121314151617M1819202122232425262728293031M3233343536373839+
Recommended
View more...
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks
SAVE OUR EARTH

We need your sign to support Project to invent "SMART AND CONTROLLABLE REFLECTIVE BALLOONS" to cover the Sun and Save Our Earth.

More details...

Sign Now!

We are very appreciated for your Prompt Action!

x